puc57 vectors (Sangon Biotech)
86
Structured Review
Sangon Biotech
puc57 vectors
Puc57 Vectors, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/puc57+vector/orf1+pcv2+pcv2+plasmid+pmd18+positive/pm42243997-82-19-22
Average 86 stars, based on 1 article reviews
Puc57 Vectors, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/puc57+vector/orf1+pcv2+pcv2+plasmid+pmd18+positive/pm42243997-82-19-22
Average 86 stars, based on 1 article reviews
puc57 vectors - by Bioz Stars,
2026-11
86/100 stars
Images
Related Articles
Sequencing:Article Title: Developing an Indirect ELISA for the Detection of African Swine Fever Virus Antibodies Using a Tag-Free p15 Protein Antigen. Article Snippet: .. The ASFV CP530R gene sequence (GenBank accession No. QBH90582.1) was adapted to E. coli codon usage using the Java Codon Adaptation Tool (https://www.prodoric.de/JCat, accessed on 6 January 2023), and then synthesized and inserted into Article Title: Development of a duplex real-time recombinase aided amplification assay for the simultaneous and rapid detection of PCV3 and PCV4 Article Snippet: .. The complete genome of PCV3 (2, 000 bp) and PCV4 (1, 770 bp) were synthesized according to the PCV3 and PCV4 genomic sequence (GenBank accession no. KT869077 and MT311852) and cloned into the Article Title: Development of a Real-Time TaqMan RT-PCR Assay for the Detection of NADC34-like Porcine Reproductive and Respiratory Syndrome Virus Article Snippet: The DNA/RNA extraction kit and reverse transcription kit were purchased from TaKaRa (Beijing, China). .. The ORF5 gene of NADC34-like PRRSV (603 bp) was synthesized artificially by Sangon Biotech (Shanghai, China) based on a reference sequence of a Chinese isolate available in GenBank (Accession number: MH370474.1) and cloned into Article Title: Carp edema virus, a great threat for carp and koi farming in Henan, China Article Snippet: A carp disease with clinical signs of acute gill rot (AGR) has frequently occurred in Henan province of China since 2013, leading to substantial economic losses.. However, the causative agent of virus-related carp AGR (CAGR) disease has been controversial.. Our study showed that carp edema virus (CEV), specifically the sub-genogroup IIa, might be the primary agent causing virus-related CAGR that is endemic to Henan, China. Article Title: Development of a duplex real-time recombinase aided amplification assay for the simultaneous and rapid detection of PCV3 and PCV4. Article Snippet: .. Standard plasmid for duplex real-time RAA The complete genome of PCV3 (2, 000 bp) and PCV4 (1, 770 bp) were synthesized according to the PCV3 and PCV4 genomic sequence (GenBank accession no. KT869077 and MT311852) and cloned into the Article Title: Partial Optimization of the 5-Terminal Codon Increased a Recombination Porcine Pancreatic Lipase (opPPL) Expression in Pichia pastoris Article Snippet: .. The optimized fragment with an additional 28 bp adapter vector sequence which included a Xho I site and both kex 2 and ste 13 signal cleavage sites ( ATCTCTCGAGAAAAGAGAGGCTGAAGCT ) on the 5-termianl (total 565 bp) sequence was synthesized and cloned into Synthesized:Article Title: Developing an Indirect ELISA for the Detection of African Swine Fever Virus Antibodies Using a Tag-Free p15 Protein Antigen. Article Snippet: .. The ASFV CP530R gene sequence (GenBank accession No. QBH90582.1) was adapted to E. coli codon usage using the Java Codon Adaptation Tool (https://www.prodoric.de/JCat, accessed on 6 January 2023), and then synthesized and inserted into Article Title: Development of a duplex real-time recombinase aided amplification assay for the simultaneous and rapid detection of PCV3 and PCV4 Article Snippet: .. The complete genome of PCV3 (2, 000 bp) and PCV4 (1, 770 bp) were synthesized according to the PCV3 and PCV4 genomic sequence (GenBank accession no. KT869077 and MT311852) and cloned into the Article Title: GWSF - EuSWAP70 gene expression to enhance gray mold resistance in Arabidopsis thaliana Article Snippet: .. Specifically, the EuSWAP70 gene was synthesized and cloned into the Article Title: Development of a Real-Time TaqMan RT-PCR Assay for the Detection of NADC34-like Porcine Reproductive and Respiratory Syndrome Virus Article Snippet: The DNA/RNA extraction kit and reverse transcription kit were purchased from TaKaRa (Beijing, China). .. The ORF5 gene of NADC34-like PRRSV (603 bp) was synthesized artificially by Sangon Biotech (Shanghai, China) based on a reference sequence of a Chinese isolate available in GenBank (Accession number: MH370474.1) and cloned into Article Title: Carp edema virus, a great threat for carp and koi farming in Henan, China Article Snippet: A carp disease with clinical signs of acute gill rot (AGR) has frequently occurred in Henan province of China since 2013, leading to substantial economic losses.. However, the causative agent of virus-related carp AGR (CAGR) disease has been controversial.. Our study showed that carp edema virus (CEV), specifically the sub-genogroup IIa, might be the primary agent causing virus-related CAGR that is endemic to Henan, China. Article Title: Development of a duplex real-time recombinase aided amplification assay for the simultaneous and rapid detection of PCV3 and PCV4. Article Snippet: .. Standard plasmid for duplex real-time RAA The complete genome of PCV3 (2, 000 bp) and PCV4 (1, 770 bp) were synthesized according to the PCV3 and PCV4 genomic sequence (GenBank accession no. KT869077 and MT311852) and cloned into the Article Title: Partial Optimization of the 5-Terminal Codon Increased a Recombination Porcine Pancreatic Lipase (opPPL) Expression in Pichia pastoris Article Snippet: .. The optimized fragment with an additional 28 bp adapter vector sequence which included a Xho I site and both kex 2 and ste 13 signal cleavage sites ( ATCTCTCGAGAAAAGAGAGGCTGAAGCT ) on the 5-termianl (total 565 bp) sequence was synthesized and cloned into Plasmid Preparation:Article Title: Developing an Indirect ELISA for the Detection of African Swine Fever Virus Antibodies Using a Tag-Free p15 Protein Antigen. Article Snippet: .. The ASFV CP530R gene sequence (GenBank accession No. QBH90582.1) was adapted to E. coli codon usage using the Java Codon Adaptation Tool (https://www.prodoric.de/JCat, accessed on 6 January 2023), and then synthesized and inserted into Article Title: Development of a duplex real-time recombinase aided amplification assay for the simultaneous and rapid detection of PCV3 and PCV4 Article Snippet: .. The complete genome of PCV3 (2, 000 bp) and PCV4 (1, 770 bp) were synthesized according to the PCV3 and PCV4 genomic sequence (GenBank accession no. KT869077 and MT311852) and cloned into the Article Title: GWSF - EuSWAP70 gene expression to enhance gray mold resistance in Arabidopsis thaliana Article Snippet: .. Specifically, the EuSWAP70 gene was synthesized and cloned into the Article Title: Carp edema virus, a great threat for carp and koi farming in Henan, China Article Snippet: A carp disease with clinical signs of acute gill rot (AGR) has frequently occurred in Henan province of China since 2013, leading to substantial economic losses.. However, the causative agent of virus-related carp AGR (CAGR) disease has been controversial.. Our study showed that carp edema virus (CEV), specifically the sub-genogroup IIa, might be the primary agent causing virus-related CAGR that is endemic to Henan, China. Article Title: In-sewer biofilm and sediment-derived suspended solids accelerate virus genome-signal decay and implications for wastewater-based epidemiology. Article Snippet: • Biofilm/sediment solids enhance viral genome-signal decay by 28–44 %.. • Solids increase thermal sensitivity of decay rates by 2–3-fold.. • T-CMD model shows 2.2–3.0-fold higher temperature sensitivity than WW-only. Article Title: Development of a duplex real-time recombinase aided amplification assay for the simultaneous and rapid detection of PCV3 and PCV4. Article Snippet: .. Standard plasmid for duplex real-time RAA The complete genome of PCV3 (2, 000 bp) and PCV4 (1, 770 bp) were synthesized according to the PCV3 and PCV4 genomic sequence (GenBank accession no. KT869077 and MT311852) and cloned into the Article Title: Partial Optimization of the 5-Terminal Codon Increased a Recombination Porcine Pancreatic Lipase (opPPL) Expression in Pichia pastoris Article Snippet: .. The optimized fragment with an additional 28 bp adapter vector sequence which included a Xho I site and both kex 2 and ste 13 signal cleavage sites ( ATCTCTCGAGAAAAGAGAGGCTGAAGCT ) on the 5-termianl (total 565 bp) sequence was synthesized and cloned into Clone Assay:Article Title: Development of a duplex real-time recombinase aided amplification assay for the simultaneous and rapid detection of PCV3 and PCV4 Article Snippet: .. The complete genome of PCV3 (2, 000 bp) and PCV4 (1, 770 bp) were synthesized according to the PCV3 and PCV4 genomic sequence (GenBank accession no. KT869077 and MT311852) and cloned into the Article Title: GWSF - EuSWAP70 gene expression to enhance gray mold resistance in Arabidopsis thaliana Article Snippet: .. Specifically, the EuSWAP70 gene was synthesized and cloned into the Article Title: Development of a Real-Time TaqMan RT-PCR Assay for the Detection of NADC34-like Porcine Reproductive and Respiratory Syndrome Virus Article Snippet: The DNA/RNA extraction kit and reverse transcription kit were purchased from TaKaRa (Beijing, China). .. The ORF5 gene of NADC34-like PRRSV (603 bp) was synthesized artificially by Sangon Biotech (Shanghai, China) based on a reference sequence of a Chinese isolate available in GenBank (Accession number: MH370474.1) and cloned into Article Title: Carp edema virus, a great threat for carp and koi farming in Henan, China Article Snippet: A carp disease with clinical signs of acute gill rot (AGR) has frequently occurred in Henan province of China since 2013, leading to substantial economic losses.. However, the causative agent of virus-related carp AGR (CAGR) disease has been controversial.. Our study showed that carp edema virus (CEV), specifically the sub-genogroup IIa, might be the primary agent causing virus-related CAGR that is endemic to Henan, China. Article Title: In-sewer biofilm and sediment-derived suspended solids accelerate virus genome-signal decay and implications for wastewater-based epidemiology. Article Snippet: • Biofilm/sediment solids enhance viral genome-signal decay by 28–44 %.. • Solids increase thermal sensitivity of decay rates by 2–3-fold.. • T-CMD model shows 2.2–3.0-fold higher temperature sensitivity than WW-only. Article Title: Development of a duplex real-time recombinase aided amplification assay for the simultaneous and rapid detection of PCV3 and PCV4. Article Snippet: .. Standard plasmid for duplex real-time RAA The complete genome of PCV3 (2, 000 bp) and PCV4 (1, 770 bp) were synthesized according to the PCV3 and PCV4 genomic sequence (GenBank accession no. KT869077 and MT311852) and cloned into the Article Title: Partial Optimization of the 5-Terminal Codon Increased a Recombination Porcine Pancreatic Lipase (opPPL) Expression in Pichia pastoris Article Snippet: .. The optimized fragment with an additional 28 bp adapter vector sequence which included a Xho I site and both kex 2 and ste 13 signal cleavage sites ( ATCTCTCGAGAAAAGAGAGGCTGAAGCT ) on the 5-termianl (total 565 bp) sequence was synthesized and cloned into Construct:Article Title: Development of a duplex real-time recombinase aided amplification assay for the simultaneous and rapid detection of PCV3 and PCV4 Article Snippet: .. The complete genome of PCV3 (2, 000 bp) and PCV4 (1, 770 bp) were synthesized according to the PCV3 and PCV4 genomic sequence (GenBank accession no. KT869077 and MT311852) and cloned into the Article Title: Carp edema virus, a great threat for carp and koi farming in Henan, China Article Snippet: A carp disease with clinical signs of acute gill rot (AGR) has frequently occurred in Henan province of China since 2013, leading to substantial economic losses.. However, the causative agent of virus-related carp AGR (CAGR) disease has been controversial.. Our study showed that carp edema virus (CEV), specifically the sub-genogroup IIa, might be the primary agent causing virus-related CAGR that is endemic to Henan, China. Article Title: Development of a duplex real-time recombinase aided amplification assay for the simultaneous and rapid detection of PCV3 and PCV4. Article Snippet: .. Standard plasmid for duplex real-time RAA The complete genome of PCV3 (2, 000 bp) and PCV4 (1, 770 bp) were synthesized according to the PCV3 and PCV4 genomic sequence (GenBank accession no. KT869077 and MT311852) and cloned into the Real-time Polymerase Chain Reaction:Article Title: Carp edema virus, a great threat for carp and koi farming in Henan, China Article Snippet: A carp disease with clinical signs of acute gill rot (AGR) has frequently occurred in Henan province of China since 2013, leading to substantial economic losses.. However, the causative agent of virus-related carp AGR (CAGR) disease has been controversial.. Our study showed that carp edema virus (CEV), specifically the sub-genogroup IIa, might be the primary agent causing virus-related CAGR that is endemic to Henan, China. Generated:Article Title: In-sewer biofilm and sediment-derived suspended solids accelerate virus genome-signal decay and implications for wastewater-based epidemiology. Article Snippet: • Biofilm/sediment solids enhance viral genome-signal decay by 28–44 %.. • Solids increase thermal sensitivity of decay rates by 2–3-fold.. • T-CMD model shows 2.2–3.0-fold higher temperature sensitivity than WW-only. |